Given the following coding strand of DNA, draw the complementary template stran…

Given the following coding strand of DNA, draw the complementary template strand, then the mRNA transcript that would be produced from it. Underline any possible start codons, and predict all possible protein sequences that could be translated from the mRNA.
5’ –…CGGAATATGGGCTATGAAATTCGGAACAAG…– 3’


More Genes and mRNA Questions: