High School
SAT
ACT
University
MCAT
LSAT
DAT

Which of the following can regulate the initiation of transcription?

Related Topics

Wize University Biology Textbook > Transcription and Translation

Genes and mRNA

9 Activities

Wize University Biology Textbook > Gene Expression & Regulation

Eukaryotic Transcriptional Regulation [Transcription Factors, Enhancers and Repressors]

3 Activities

Wize University Biology Textbook > Gene Expression & Regulation

Eukaryotic Epigenetic Regulation

4 Activities

Which of the following can regulate the initiation of transcription?
More Genes and mRNA Questions:
Match the correct options.
tRNA
Why are there so many tRNA molecules?
The genetic code has 64 distinct codons but only 20 amino acids. The fact that more than one codon codes for the same amino acid means the genetic code is ________.
The wobble position refers to which nucleotide in a codon?
Codons
How many amino acids are coded in this mRNA fragment?
AUCGAUGCGUUUAGGCCUU
A three nucleotide sequence that corresponds to a specific amino acid found in mRNA is referred to as what:
A three nucleotide sequence that corresponds to a specific amino acid found in mRNA is referred to as what:
In eukaryotes, genes that are expressed together are often found on different chromosomes. True or False:
True or false, the genome size of organisms correlates well with the
complexity of an organism.
Which of the following commonly make up RNA's secondary structure?
Someone tells you "A change is the genetic sequence will always result in a change in protein sequence". Are they right or wrong?
Practice: tRNA vs mRNA
An anticodon of a tRNA has the sequence 5'-GCA-3'. Use an amino acid table like the one from the theory to help you!
a) What amino acid does the tRNA carry?
b) What is a complimentary mRNA codon?
Genetic Code
The Genetic Code is said to be universal and redundant, and non-overlapping. What does that mean?
The genetic code is considered redundant (codon degeneracy), why?
A three nucleotide sequence that corresponds to a specific amino acid found in mRNA is referred to as what:
There are ___ stop codons, and ____ start codons.
Practice: DNA encoding
Given the mRNA strand below, determine the DNA encoding this region (template and non-template strand).
5'-AUGGCAGGAC-3'
Practice: Translation
Match the correct options.
A stop codon...
is the last 3 bases translated into an amino acid
base pairs with a tRNA
The synthesis, processing and function of a eukaryotic miRNA involves complimentary base pairing with which of the following?
DNA
tRNA
If the codon for arginine in DNA is 3'GCA, what would be the expected tRNA anticodon sequence?
Which of the following statements are true regarding open reading frames of a gene?
They do not code for proteins
They represent a complete gene
There is an insertion in a eukaryotic gene as shown below. Which of the following amino acid sequences are the result of this insertion?
Which of the following would be found in both the eukaryotic genes encoding ribosomal proteins and ribosomal rRNA?
A protein is coding for Proline-Histidine-Serine-Threonine, if the below listed DNA sequences are shown from 5' to 3', which DNA sequence would be used as a template for the mRNA strand that codes for this string of amino acids?
Which of the following is false regarding codons?
The wobble position refers to which nucleotide in a codon?
How does RNA present itself?
The genetic code has 64 distinct codons but only 20 amino acids. The fact that more than one codon codes for the same amino acid means the genetic code is ________.
Which of the following is false regarding transcription?
Practice: tRNA
Which of the following statements pertains to tRNAs?
Use the codon dictionary below to complete the following table. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments.
tRNA
Why are there so many tRNA molecules?
Codons
How many amino acids are coded in this mRNA fragment?
ATCGAUGCGTTTAGGCCT
Match the correct options.
Given the following coding strand of DNA, draw the complementary template strand, then the mRNA transcript that would be produced from it. Underline any possible start codons, and predict all possible protein sequences that could be translated from the mRNA.
5’ –…CGGAATATGGGCTATGAAATTCGGAACAAG…– 3’
Practice: mRNA
Which of the following are found in a mature mRNA molecule?
More Eukaryotic Transcriptional Regulation [Transcription Factors, Enhancers and Repressors] Questions:
Why is annotating a eukaryotic genome a lot more difficult than a prokaryotic genome?
The human body often expresses different proteins or amounts of proteins originating from the same gene in different tissues. Which of the following are possible explanations for this phenomena?
Which of the following proteins would you find bound to DNA during eukaryotic gene expression?
Practice: Gene Mechanisms
You are doing an experiment to determine the mechanism of gene
expression of a bacterial operon responsible for the utilization of glycerol. You know Abc1 is the regulator. You have two strains of the bacteria: one has the normal Abc1 regulator (+abc1), and the other does not (-abc1). You obtain the following results when growing the two strains with and without glycerol:
Describe the mechanism of regulation.
Write a point form essay outline for the following prompt:
The central dogma of molecular biology is that DNA is transcribed to RNA, which is translated into protein. As such, when we think of DNA, we often picture transcriptionally active euchromatin. However, approx. 10% of interphase DNA in eukaryotes is organized as transcriptionally inactive heterochromatin. Explain the importance of heterochromatin.
Thesis statement:
The retinoblastoma (Rb) protein is named after a rare form of cancer that affects the retina (the light-detecting tissue of the eye). In patients with this type of cancer, what do you think has happened to the Rb protein?
More Eukaryotic Epigenetic Regulation Questions:
Practice: Epigenetics
Epigenetic changes do NOT...
Epigenetic changes do NOT...
The expression of the Wingless (Wnt) gene in drosophila results in the normal development of fly wings. However, when the Wnt gene is not expressed, the flies have develop very short wings. You are studying a particular fly in which the expression levels of Wnt is linked to a histone acetylase, which acetylates lysines near the Wnt gene. How might this acetylation affect the fly?
Practice: Eukaryotic Cells
Certain proteins are nearly universal amongst eukaryotic cells. However, when comparing different organisms, the sequences of the genes that encode these proteins can vary quite a bit.
Provide two explanations as to how this may be possible.
Practice Problem 5
A histone-modifying enzyme adds acetyl groups to lysines on the tails of nucleosome core histones. Lysine is normally positively charged, but this modification neutralizes the charge. What might happen if you mutated this enzyme so that it became non-functional?