High School
SAT
SAT Elite 1500
SAT Tutoring
ACT
ACT Elite 33
ACT Tutoring
University
MCAT
MCAT Elite 515
Med-School Admissions
Pre-Med Tutoring
Pre-Med Plus
LSAT
LSAT Elite 170
LSAT Self-Paced
LSAT Tutoring
DAT
DAT Elite
DAT Tutoring
Log in
Get Started for Free
There is an insertion in a eukaryotic gene as shown below. Which of the followi…
Related Topics
Wize University Biology Textbook > Transcription and Translation
Genes and mRNA
9 Activities
There is an insertion in a eukaryotic gene as shown below. Which of the following amino acid sequences are the result of this insertion?
Met-Gly-His-Leu
Val-Tyr-Arg-Val
Met-Glu-Pro-Phe
Val-Ala-Asp-Gly
I don't know
Check Submission
More Genes and mRNA Questions:
Match the correct options.
tRNA
Why are there so many tRNA molecules?
The genetic code has 64 distinct codons but only 20 amino acids. The fact that more than one codon codes for the same amino acid means the genetic code is ________.
The wobble position refers to which nucleotide in a codon?
Codons
How many amino acids are coded in this mRNA fragment?
AUCGAUGCGUUUAGGCCUU
A three nucleotide sequence that corresponds to a specific amino acid found in mRNA is referred to as what:
A three nucleotide sequence that corresponds to a specific amino acid found in mRNA is referred to as what:
In eukaryotes, genes that are expressed together are often found on different chromosomes. True or False:
True or false, the genome size of organisms correlates well with the
complexity of an organism.
Which of the following commonly make up RNA's secondary structure?
Someone tells you "A change is the genetic sequence will always result in a change in protein sequence". Are they right or wrong?
Practice: tRNA vs mRNA
An anticodon of a tRNA has the sequence 5'-GCA-3'. Use an amino acid table like the one from the theory to help you!
a) What amino acid does the tRNA carry?
b) What is a complimentary mRNA codon?
Genetic Code
The Genetic Code is said to be universal and redundant, and non-overlapping. What does that mean?
The genetic code is considered redundant (codon degeneracy), why?
A three nucleotide sequence that corresponds to a specific amino acid found in mRNA is referred to as what:
There are ___ stop codons, and ____ start codons.
Practice: DNA encoding
Given the mRNA strand below, determine the DNA encoding this region (template and non-template strand).
5'-AUGGCAGGAC-3'
Practice: Translation
Match the correct options.
A stop codon...
is the last 3 bases translated into an amino acid
base pairs with a tRNA
The synthesis, processing and function of a eukaryotic miRNA involves complimentary base pairing with which of the following?
DNA
tRNA
If the codon for arginine in DNA is 3'GCA, what would be the expected tRNA anticodon sequence?
Which of the following statements are true regarding open reading frames of a gene?
They do not code for proteins
They represent a complete gene
Which of the following would be found in both the eukaryotic genes encoding ribosomal proteins and ribosomal rRNA?
A protein is coding for Proline-Histidine-Serine-Threonine, if the below listed DNA sequences are shown from 5' to 3', which DNA sequence would be used as a template for the mRNA strand that codes for this string of amino acids?
Which of the following is false regarding codons?
The wobble position refers to which nucleotide in a codon?
Which of the following can regulate the initiation of transcription?
How does RNA present itself?
The genetic code has 64 distinct codons but only 20 amino acids. The fact that more than one codon codes for the same amino acid means the genetic code is ________.
Which of the following is false regarding transcription?
Practice: tRNA
Which of the following statements pertains to tRNAs?
Use the codon dictionary below to complete the following table. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments.
tRNA
Why are there so many tRNA molecules?
Codons
How many amino acids are coded in this mRNA fragment?
ATCGAUGCGTTTAGGCCT
Match the correct options.
Given the following coding strand of DNA, draw the complementary template strand, then the mRNA transcript that would be produced from it. Underline any possible start codons, and predict all possible protein sequences that could be translated from the mRNA.
5’ –…CGGAATATGGGCTATGAAATTCGGAACAAG…– 3’
Practice: mRNA
Which of the following are found in a mature mRNA molecule?