High School
SAT
ACT
University
MCAT
LSAT
DAT

Match the correct options.

Related Topics

Wize University Biology Textbook > Transcription and Translation

Translation into Proteins

7 Activities

Wize University Biology Textbook > Transcription and Translation

Genes and mRNA

9 Activities

Match the correct options.
A.
Met (start codon)
B.
Stop codon
C.
Exit site
D.
Wobble position
E.
Amino acid-tRNA binding site
F.
Peptide bond-tRNA binding site
AUG
UAA, UAG, UGA
Position 3 of the codon
E site
P site
A site
More Translation into Proteins Questions:
Match the correct options.
tRNA
Why are there so many tRNA molecules?
Which of the following statements is true regarding translation?
What type of interaction occurs between the codon of the mRNA and anticodon of the tRNA:
What end of the protein molecule is synthesized first?
What is the role of tRNA?
a) Read mRNA codons using anticodons and assemble amino acids in the proper sequence to make a protein
b) Package and transport proteins to various locations in the cell
Where do both transcription and translation take place in eukaryotes?
Ribosomes
What are ribosomes responsible for producing?
Practice: tRNA vs mRNA
An anticodon of a tRNA has the sequence 5'-GCA-3'. Use an amino acid table like the one from the theory to help you!
a) What amino acid does the tRNA carry?
b) What is a complimentary mRNA codon?
The ribosome is made up of
The ribosome preforms the process called _____ while RNA polymerase preforms the process called ____
Practice: Translation
Match the correct options.
Practice: Components for Protein Translation
Which of the following is not necessary for protein translation to occur?
Which of the following functions as an RNA-protein complex?
Ribosomes
snRNPs
If the codon for arginine in DNA is 3'GCA, what would be the expected tRNA anticodon sequence?
Consider a typical prokaryotic gene as shown. Which of the numbers indicates a sequence that is transcribed but not translated?
Why is annotating a eukaryotic genome a lot more difficult than a prokaryotic genome?
What is required before the elongation of a polypeptide in a prokaryotic cell can begin?
How is a finished polypeptide released from the ribosome?
Which of the following is not necessary for protein translation to occur?
What is synthesized at the N-termini of every polypeptide in eukaryotes?
What is the first amino acid of a translated polypeptide?
If a reading frame shift occurs during translation of an mRNA transcript, what is the MOST likely outcome?
Match the following enzymes with their function.
Translation and Primary structure Question
A protein coding polypeptide chain... (select all that apply)
Translation
Which of the following statements is true regarding translation?
Use the codon dictionary below to complete the following table. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments.
Translation Initiation
How is translation initiation different between prokaryotes and eukaryotes?
tRNA
Why are there so many tRNA molecules?
Explain the stages of translation elongation including the ribosomal sites in your answer.
Membrane Proteins
If a random protein was mutated, what effect do you think that the following amino acid substitutions would have on the structure of the protein? Would these substitutions affect secondary, tertiary, or quaternary protein structure?
a. Cys →\rightarrow Pro
b. Asp →\rightarrowLys
More Genes and mRNA Questions:
Match the correct options.
tRNA
Why are there so many tRNA molecules?
The genetic code has 64 distinct codons but only 20 amino acids. The fact that more than one codon codes for the same amino acid means the genetic code is ________.
The wobble position refers to which nucleotide in a codon?
Codons
How many amino acids are coded in this mRNA fragment?
AUCGAUGCGUUUAGGCCUU
A three nucleotide sequence that corresponds to a specific amino acid found in mRNA is referred to as what:
A three nucleotide sequence that corresponds to a specific amino acid found in mRNA is referred to as what:
In eukaryotes, genes that are expressed together are often found on different chromosomes. True or False:
True or false, the genome size of organisms correlates well with the
complexity of an organism.
Which of the following commonly make up RNA's secondary structure?
Someone tells you "A change is the genetic sequence will always result in a change in protein sequence". Are they right or wrong?
Practice: tRNA vs mRNA
An anticodon of a tRNA has the sequence 5'-GCA-3'. Use an amino acid table like the one from the theory to help you!
a) What amino acid does the tRNA carry?
b) What is a complimentary mRNA codon?
Genetic Code
The Genetic Code is said to be universal and redundant, and non-overlapping. What does that mean?
The genetic code is considered redundant (codon degeneracy), why?
A three nucleotide sequence that corresponds to a specific amino acid found in mRNA is referred to as what:
There are ___ stop codons, and ____ start codons.
Practice: DNA encoding
Given the mRNA strand below, determine the DNA encoding this region (template and non-template strand).
5'-AUGGCAGGAC-3'
Practice: Translation
Match the correct options.
A stop codon...
is the last 3 bases translated into an amino acid
base pairs with a tRNA
The synthesis, processing and function of a eukaryotic miRNA involves complimentary base pairing with which of the following?
DNA
tRNA
If the codon for arginine in DNA is 3'GCA, what would be the expected tRNA anticodon sequence?
Which of the following statements are true regarding open reading frames of a gene?
They do not code for proteins
They represent a complete gene
There is an insertion in a eukaryotic gene as shown below. Which of the following amino acid sequences are the result of this insertion?
Which of the following would be found in both the eukaryotic genes encoding ribosomal proteins and ribosomal rRNA?
A protein is coding for Proline-Histidine-Serine-Threonine, if the below listed DNA sequences are shown from 5' to 3', which DNA sequence would be used as a template for the mRNA strand that codes for this string of amino acids?
Which of the following is false regarding codons?
The wobble position refers to which nucleotide in a codon?
Which of the following can regulate the initiation of transcription?
How does RNA present itself?
The genetic code has 64 distinct codons but only 20 amino acids. The fact that more than one codon codes for the same amino acid means the genetic code is ________.
Which of the following is false regarding transcription?
Practice: tRNA
Which of the following statements pertains to tRNAs?
Use the codon dictionary below to complete the following table. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments.
tRNA
Why are there so many tRNA molecules?
Codons
How many amino acids are coded in this mRNA fragment?
ATCGAUGCGTTTAGGCCT
Given the following coding strand of DNA, draw the complementary template strand, then the mRNA transcript that would be produced from it. Underline any possible start codons, and predict all possible protein sequences that could be translated from the mRNA.
5’ –…CGGAATATGGGCTATGAAATTCGGAACAAG…– 3’
Practice: mRNA
Which of the following are found in a mature mRNA molecule?