High School
SAT
ACT
University
MCAT
LSAT
DAT
Wize University Biology Textbook > Transcription and Translation

Translation into Proteins

RNA Maturation in EukaryotesPrevious Section
Introduction to Regulation of Gene ExpressionNext Section
Popular Courses
Find My Course
0:00 / 0:00

Translation into Proteins

Recall that translation of mRNA into proteins is done by a cellular organelle called the ribosome.
  • The ribosome is composed of a small subunit and a large subunit made from rRNA and proteins.
  • The ribosome contains three sites:
  • A (aminoacyl) site: the acceptor site for an aminoacyl-tRNA.
  • P (peptidyl) site: the site where the peptide bond forms between the amino acid and the growing polypeptide chain.
  • E (exit) site: the site where the tRNAs exit the ribosome.
  • Translation occurs in three steps: (1) initiation, (2) elongation, and (3) termination.

Initiation

  1. When the mRNA enters the cytosol, the 5' end of the mRNA binds to the small subunit of the ribosome.
  2. A tRNA carrying the amino acid methionine arrives at the P site (peptidyl site) of the ribosome and binds to the start codon (AUG).
  3. Next, the large subunit binds and completes the initiation complex.


PAGE BREAK

Elongation

  1. A tRNA for the next codon attaches to the A site (aminoacyl site). The carboxyl end (C-terminus) of the methionine forms a peptide bond with the amine end (N-terminus) of the amino acid at the A site (catalyzed by peptidyl transferase).
  2. The ribosome shifts three nucleotides toward the 3' end of the mRNA in a step called translocation, shifting the tRNA that held the methionine to the E site (exit site), and the tRNA carrying the dipeptide moves from the A site to the P site.
  3. The A site is now available for another tRNA.


PAGE BREAK

Termination

When a stop codon is reached, release factor proteins bind to the A site, releasing the polypeptide from the tRNA and ribosome.


0:00 / 0:00

Differences in Eukaryotic and Prokaryotic Translation

Differences

  • Ribosomes
  • Eukaryote: 80S ribosome: made up of a 60S subunit bound to a 40S subunit.
  • Prokaryote: 70S ribosome: made up of a 50S subunit bound to a 30S subunit.

Similarities

  • Relatively the same process (initiation, elongation, and termination).
  • Same codon codes and amino acids, including start and stop codons.
  • Occurs in the cytoplasm.
  • Involves ribosomes, rRNA and tRNA.

0:00 / 0:00

Example: Translation and Reading Frame

Given the following sequence, translate the three possible reading frames assuming the first reading frame starts with the first A, the second reading frame starts with the first G and the third reading frame starts with the first U.

AGU UCC CGU AUC AAG GCC CGA


Reading frame 1 (starting with AGU): Ser-Ser-Arg-Ile-Lys-Ala-Arg
Reading frame 2 (starting with GUU): Val-Pro-Val-Ser-Arg-Pro
Reading frame 3: (starting with UUC): Phe-Pro-Tyr-Gln-Gly-Pro

Example: Transcription

The DNA strand of a hypothetical genome is shown below. Transcription begins at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the Transcription Terminator.

a) Which strand of DNA shown, the top or bottom, is the coding strand?

Top strand (coding = non-template). DNA is read 3’ to 5’ so the bottom is the template.

b) What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends.

5’ – GAAUGGCCCAUUAUCUAUAGUCUCACU – 3’

c) What is the sequence of the protein produced from the mRNA which is produced from this gene
Label the N and C terminals.

N – methionine-alanine-histidine-tyrosine-leucine– C

d) If a mutation is found where a G/C (top/bottom) base pair were added immediately after the T/A base pair in bold, what would be the sequence of the mRNA? What would be the sequence of the protein?

5’ – GAAUGGCCCAUUAGUCUAUAGUCUCACU – 3’
N – methionine-alanine-histidine- C


Transcription vs Translation Chart


Practice: Components for Protein Translation

Which of the following is not necessary for protein translation to occur?

Practice: Translation

Match the correct options.
A.
Amino acid-tRNA binding site
B.
Peptide bond-tRNA binding site
C.
Stop codon
D.
Exit site
E.
Met (start codon)
F.
Wobble position
AUG
UAA, UAG, UGA
Position 3 of the codon
E site
P site
A site
Extra Practice
Match the correct options.
tRNA
Why are there so many tRNA molecules?
Which of the following statements is true regarding translation?
What type of interaction occurs between the codon of the mRNA and anticodon of the tRNA:
What end of the protein molecule is synthesized first?
What is the role of tRNA?
a) Read mRNA codons using anticodons and assemble amino acids in the proper sequence to make a protein
b) Package and transport proteins to various locations in the cell
Where do both transcription and translation take place in eukaryotes?
Ribosomes
What are ribosomes responsible for producing?
Practice: tRNA vs mRNA
An anticodon of a tRNA has the sequence 5'-GCA-3'. Use an amino acid table like the one from the theory to help you!
a) What amino acid does the tRNA carry?
b) What is a complimentary mRNA codon?
The ribosome is made up of
The ribosome preforms the process called _____ while RNA polymerase preforms the process called ____
Practice: Translation
Match the correct options.
Practice: Components for Protein Translation
Which of the following is not necessary for protein translation to occur?
Which of the following functions as an RNA-protein complex?
Ribosomes
snRNPs
If the codon for arginine in DNA is 3'GCA, what would be the expected tRNA anticodon sequence?
Consider a typical prokaryotic gene as shown. Which of the numbers indicates a sequence that is transcribed but not translated?
Why is annotating a eukaryotic genome a lot more difficult than a prokaryotic genome?
What is required before the elongation of a polypeptide in a prokaryotic cell can begin?
How is a finished polypeptide released from the ribosome?
Which of the following is not necessary for protein translation to occur?
What is synthesized at the N-termini of every polypeptide in eukaryotes?
What is the first amino acid of a translated polypeptide?
If a reading frame shift occurs during translation of an mRNA transcript, what is the MOST likely outcome?
Match the following enzymes with their function.
Translation and Primary structure Question
A protein coding polypeptide chain... (select all that apply)
Translation
Which of the following statements is true regarding translation?
Use the codon dictionary below to complete the following table. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments.
Translation Initiation
How is translation initiation different between prokaryotes and eukaryotes?
tRNA
Why are there so many tRNA molecules?
Explain the stages of translation elongation including the ribosomal sites in your answer.
Match the correct options.
Membrane Proteins
If a random protein was mutated, what effect do you think that the following amino acid substitutions would have on the structure of the protein? Would these substitutions affect secondary, tertiary, or quaternary protein structure?
a. Cys →\rightarrow Pro
b. Asp →\rightarrowLys