High School
SAT
ACT
University
MCAT
LSAT
DAT

A protein is coding for Proline-Histidine-Serine-Threonine, if the below listed…

Related Topics

Wize University Biology Textbook > Transcription and Translation

Eukaryotic Transcription

2 Activities

Wize University Biology Textbook > Transcription and Translation

Genes and mRNA

9 Activities

A protein is coding for Proline-Histidine-Serine-Threonine, if the below listed DNA sequences are shown from 5' to 3', which DNA sequence would be used as a template for the mRNA strand that codes for this string of amino acids?



More Eukaryotic Transcription Questions:
Predict the effects of the following mutations. (Note that heritable mutations occur in the DNA, but I am giving you the mRNA version in order to simplify things. Assume that codons are in frame.)
a. AUG →\rightarrowAUA
b. AG splice site →\rightarrowAA
Prokaryotic transcription differs from eukaryotic transcription in that... (select all that apply)
Practice: Eukaryotic vs. Prokaryotic Transcription
Which of the following is incorrect regarding the differences between prokaryotic and eukaryotic transcription?
There is a gene that codes for a protein that is differentially expressed in lung and heart tissue. What are some possible ways that this gene is post-transcriptionally regulated?
Practice: Eukaryotic vs. Prokaryotic Transcription
Which of the following is incorrect regarding the differences between prokaryotic and eukaryotic transcription?
Which of the following are understood by the eukaryotic cell as RNA in the nucleus? - Practice Question
Which of the following are understood by the eukaryotic cell as RNA in the nucleus?
Start codon
Intron-exon boundaries
What is the role of tRNA?
a) Read mRNA codons using anticodons and assemble amino acids in the proper sequence to make a protein
b) Package and transport proteins to various locations in the cell
Where do both transcription and translation take place in eukaryotes?
The diagram represents regions around a gene encoding a mRNA. The translation initiation codon (AUG) is present in exon 1 of the mRNA. The stop codon (UGA) is present in exon 4.
Where is the TATA box located?
What is the base sequence of the DNA template sequence from which the following mRNA sequence is derived?
5'-GGUAUC-3'
__________ regulate which genes or subset of genes are transcribed in a particular cell type:
What is the base sequence of the mRNA strand that would be synthesized from the following DNA template strand?
5'-GTTAAC-3'
RNA is synthesized on a DNA template in a process called __________, which utilizes the enzyme __________:
Which of the following statements are false?
i. Introns are the coding regions in DNA
ii. Exons are the non-coding regions in DNA
Which of the following commonly make up RNA's secondary structure?
In eukaryotes, which of the following is true about transcription:
i. Removal of exons
ii. Addition of a poly-U tail
RNA polymerase (in prokaryotes) requires what subunit in order to recognize the promoter sequence?
What is the base sequence of the mRNA strand that would be synthesized from the following DNA template strand?
5'-GTTAAC-3'
RNA is synthesized on a DNA template in a process called __________, which utilizes the enzyme __________:
What are the three stages of transcription?
The ribosome preforms the process called _____ while RNA polymerase preforms the process called ____
If you found a drug that inhibits transcription but cannot enter the nucleus what would it be useful for?
Practice: DNA encoding
Given the mRNA strand below, determine the DNA encoding this region (template and non-template strand).
5'-AUGGCAGGAC-3'
Transcription
Label the following statements as true or false
A. When RNA polymerase transcribes DNA in to RNA, the RNA is an exact copy of the DNA stand being transcribed.
B. Uracil complements with adenine in RNA.
Which of the following are understood by the eukaryotic cell as RNA in the nucleus? - Practice Question
Which of the following are understood by the eukaryotic cell as RNA in the nucleus?
The synthesis, processing and function of a eukaryotic miRNA involves complimentary base pairing with which of the following?
DNA
tRNA
Which of the following are neither transcribed nor translated?
TATA box
Enhancer
Which of the following information is understood by the cell in the form of RNA?
Consider a gene that has moved through lateral gene transfer from the mitochondria to the nucleus. This gene, although now in the nucleus, still exerts its function in the mitochondria. What would this gene absolutely need to acquire in order to be properly expressed?
Which of the following would be found in both the eukaryotic genes encoding ribosomal proteins and ribosomal rRNA?
The human body often expresses different proteins or amounts of proteins originating from the same gene in different tissues. Which of the following are possible explanations for this phenomena?
You express the transcription factor BTF3 fused to a green fluorescent protein (GFP). Using live cell imaging immunofluorescent microscopy you want to visualize the localization of this protein in the cell. Under the microscope, where would you expect to see positive signal?
There is a gene that codes for a protein that is differentially expressed in lung and heart tissue. What are some possible ways that this gene is post-transcriptionally regulated?
Which of the following components would be coded for in the DNA of the rhodopsin gene?
Which of the following proteins would you find bound to DNA during eukaryotic gene expression?
You treat a eukaryotic cell with a compound that is a zinc-finger inhibitor by acting to pull the zinc ions away from those proteins. Which of the following would be inhibited by such a compound?
Using a fluorescently tagged antibody for TATA binding protein, the transcription factor that binds the TATA box, where in the cell would you see fluorescence under a fluorescent microscope?
Where in the Chlamydomonas cell would you find mRNA with a 5’ CAP?
Which of the following is understood by a eukaryotic cell as RNA found in the cytoplasm?
Which of the following is true of histones?
Practice: cDNA Length
Does the length of a gene always correlate to the length of the cDNA of that gene (e.g. Does a gene that is 1kb long have a longer cDNA sequence than a gene that is only 600kb long)? Why or why not?
Which RNA polymerases are required to transcribe rRNA?
Prokaryotic transcription differs from eukaryotic transcription in that... (select all that apply)
Practice: Eukaryotic vs. Prokaryotic Transcription
Which of the following is incorrect regarding the differences between prokaryotic and eukaryotic transcription?
Draw a two-intron eukaryotic gene and its pre-mRNA and mRNA products.
Predict the effects of the following mutations. (Note that heritable mutations occur in the DNA, but I am giving you the mRNA version in order to simplify things. Assume that codons are in frame.)
a. AUG →\rightarrowAUA
b. AG splice site →\rightarrowAA
Practice: Transcription & Translation
Both transcription and translation are said to proceed via three steps: initiation, elongation, and termination. Focusing on eukaryotes, summarize each step for transcription and translation.
Practice: Exam Question
This is a very complicated image that is quite popular as an exam question. Match the letters on the micrograph with the following terms:
Where is this process occurring? Explain.
More Genes and mRNA Questions:
Match the correct options.
tRNA
Why are there so many tRNA molecules?
The genetic code has 64 distinct codons but only 20 amino acids. The fact that more than one codon codes for the same amino acid means the genetic code is ________.
The wobble position refers to which nucleotide in a codon?
Codons
How many amino acids are coded in this mRNA fragment?
AUCGAUGCGUUUAGGCCUU
A three nucleotide sequence that corresponds to a specific amino acid found in mRNA is referred to as what:
A three nucleotide sequence that corresponds to a specific amino acid found in mRNA is referred to as what:
In eukaryotes, genes that are expressed together are often found on different chromosomes. True or False:
True or false, the genome size of organisms correlates well with the
complexity of an organism.
Which of the following commonly make up RNA's secondary structure?
Someone tells you "A change is the genetic sequence will always result in a change in protein sequence". Are they right or wrong?
Practice: tRNA vs mRNA
An anticodon of a tRNA has the sequence 5'-GCA-3'. Use an amino acid table like the one from the theory to help you!
a) What amino acid does the tRNA carry?
b) What is a complimentary mRNA codon?
Genetic Code
The Genetic Code is said to be universal and redundant, and non-overlapping. What does that mean?
The genetic code is considered redundant (codon degeneracy), why?
A three nucleotide sequence that corresponds to a specific amino acid found in mRNA is referred to as what:
There are ___ stop codons, and ____ start codons.
Practice: DNA encoding
Given the mRNA strand below, determine the DNA encoding this region (template and non-template strand).
5'-AUGGCAGGAC-3'
Practice: Translation
Match the correct options.
A stop codon...
is the last 3 bases translated into an amino acid
base pairs with a tRNA
The synthesis, processing and function of a eukaryotic miRNA involves complimentary base pairing with which of the following?
DNA
tRNA
If the codon for arginine in DNA is 3'GCA, what would be the expected tRNA anticodon sequence?
Which of the following statements are true regarding open reading frames of a gene?
They do not code for proteins
They represent a complete gene
There is an insertion in a eukaryotic gene as shown below. Which of the following amino acid sequences are the result of this insertion?
Which of the following would be found in both the eukaryotic genes encoding ribosomal proteins and ribosomal rRNA?
Which of the following is false regarding codons?
The wobble position refers to which nucleotide in a codon?
Which of the following can regulate the initiation of transcription?
How does RNA present itself?
The genetic code has 64 distinct codons but only 20 amino acids. The fact that more than one codon codes for the same amino acid means the genetic code is ________.
Which of the following is false regarding transcription?
Practice: tRNA
Which of the following statements pertains to tRNAs?
Use the codon dictionary below to complete the following table. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments.
tRNA
Why are there so many tRNA molecules?
Codons
How many amino acids are coded in this mRNA fragment?
ATCGAUGCGTTTAGGCCT
Match the correct options.
Given the following coding strand of DNA, draw the complementary template strand, then the mRNA transcript that would be produced from it. Underline any possible start codons, and predict all possible protein sequences that could be translated from the mRNA.
5’ –…CGGAATATGGGCTATGAAATTCGGAACAAG…– 3’
Practice: mRNA
Which of the following are found in a mature mRNA molecule?